Not logged in : Login
(Sponging disallowed)

About: Actbl2_CC_802     Goto   Sponge   NotDistinct   Permalink

An Entity of Type : owl:Ontology, within Data Space : demo.openlinksw.com associated with source document(s)

Rationale: Using VGLUT1 Venus Knock In Mice, synaptosomes were purified using sucrose sedimentation followed by FAC sorting (titled Fluorescence Activated Synaptosome Sorting (FASS) in the paper). Samples were then separated using SDS-PAGE and then analyzed by LC-MS/MS.. Experimental description: GENERATION OF VGLUT1VENUS KI MICE. The targeting vector was constructed on the basis of a 14 kb genomic clone of the VGLUT1 locus in pBluescript, which had been isolated from a λFIXII genomic library of the SV129 mouse strain (Stratagene). In the targeting vector, the STOP codon in the last coding exon (exon 12) of the VGLUT1 gene was replaced in-frame by a venus-loxP-neor-loxP cassette using recombineering techniques with engineered primers. The Venus cDNA was kindly provided by Dr. A. Miyawaki (RIKEN, Wako, Japan), and the recombineering toolbox was provided by Dr. N. Copeland (NCI, Frederick, MD). The venus-loxP-neor-loxP cassette was inserted between a 6.7 kb genomic sequence in 5′ position and a 7.9 kb genomic sequence in 3′ position (Fig. 1C). Mice carrying the mutated VGLUT1VenusNeo gene (VGLUT1vn/+) were generated by homologous recombination in embryonic stem cells (SV129/ola) as described previously (Thomas and Capecchi, 1987; Augustin et al., 1999) and identified by Southern blotting or PCR (Fig. 1D,E). To eliminate deleterious effects of the neomycin resistance gene, we crossed heterozygous VGLUT1vn/+ mice with EIIa-cre mice that express Cre recombinase in early embryonic stages (Lakso et al., 1996). Successfully recombined VGLUT1Venus alleles (v/+) in offspring from these interbreedings were genotyped by PCR (Fig. 1D). Except for initial comparative analyses of VGLUT1VenusNeo and VGLUT1Venus mice (Fig. 1), Cre recombined VGLUT1Venus mice were used for all experiments. All experiments were performed with littermates derived from crossing heterozygous VGLUT1v/+ or homozygous VGLUT1v/v mice (F2 SV129/ola × C57BL/6 genetic background). All live imaging experiments were performed on VGLUT1v/v mice. The probe used for embryonic stem (ES) cell screening by Southern blot was amplified from the VGLUT1 locus. It is located on the mouse chromosome 7 contig NT_039424.7 at position 6081938–6082223. The following oligonucleotides were used for genotyping PCRs: 9420, CTGGCTGGCAGTGACGAAAG; 9421, CGCTCAGGCTAGAGGTGTATGGA; 9423, CTTCAAGATCCGCCACAACATCG; 4174, CGCATCGCCTTCTATCGCCTTCTT. Oligonucleotides 9420 and 9421 were used to amplify the WT VGLUT1 allele, oligonucleotides 9421 and 9423 were used to amplify the VGLUT1v allele, and oligonucleotides 9421 and 4174 were used to amplify the VGLUT1vn allele. (Herzog et. al. In vivo imaging of intersynaptic vesicle exchange using VGLUT1 Venus knock-in mice. J Neurosci 2011 Oct 26: 31(43): 15544-59. PMID: 22031900)GENERATION OF VGLUT1VENUS KI MICE. The targeting vector was constructed on the basis of a 14 kb genomic clone of the VGLUT1 locus in pBluescript, which had been isolated from a λFIXII genomic library of the SV129 mouse strain (Stratagene). In the targeting vector, the STOP codon in the last coding exon (exon 12) of the VGLUT1 gene was replaced in-frame by a venus-loxP-neor-loxP cassette using recombineering techniques with engineered primers. The Venus cDNA was kindly provided by Dr. A. Miyawaki (RIKEN, Wako, Japan), and the recombineering toolbox was provided by Dr. N. Copeland (NCI, Frederick, MD). The venus-loxP-neor-loxP cassette was inserted between a 6.7 kb genomic sequence in 5′ position and a 7.9 kb genomic sequence in 3′ position (Fig. 1C). Mice carrying the mutated VGLUT1VenusNeo gene (VGLUT1vn/+) were generated by homologous recombination in embryonic stem cells (SV129/ola) as described previously (Thomas and Capecchi, 1987; Augustin et al., 1999) and identified by Southern blotting or PCR (Fig. 1D,E). To eliminate deleterious effects of the neomycin resistance gene, we crossed heterozygous VGLUT1vn/+ mice with EIIa-cre mice that express Cre recombinase in early embryonic stages (Lakso et al., 1996). Successfully recombined VGLUT1Venus alleles (v/+) in offspring from these interbreedings were genotyped by PCR (Fig. 1D). Except for initial comparative analyses of VGLUT1VenusNeo and VGLUT1Venus mice (Fig. 1), Cre recombined VGLUT1Venus mice were used for all experiments. All experiments were performed with littermates derived from crossing heterozygous VGLUT1v/+ or homozygous VGLUT1v/v mice (F2 SV129/ola × C57BL/6 genetic background). All live imaging experiments were performed on VGLUT1v/v mice. The probe used for embryonic stem (ES) cell screening by Southern blot was amplified from the VGLUT1 locus. It is located on the mouse chromosome 7 contig NT_039424.7 at position 6081938–6082223. The following oligonucleotides were used for genotyping PCRs: 9420, CTGGCTGGCAGTGACGAAAG; 9421, CGCTCAGGCTAGAGGTGTATGGA; 9423, CTTCAAGATCCGCCACAACATCG; 4174, CGCATCGCCTTCTATCGCCTTCTT. Oligonucleotides 9420 and 9421 were used to amplify the WT VGLUT1 allele, oligonucleotides 9421 and 9423 were used to amplify the VGLUT1v allele, and oligonucleotides 9421 and 4174 were used to amplify the VGLUT1vn allele. (Herzog et. al. In vivo imaging of intersynaptic vesicle exchange using VGLUT1 Venus knock-in mice. J Neurosci 2011 Oct 26: 31(43): 15544-59. PMID: 22031900)

AttributesValues
type
imports
comment
  • Rationale: Using VGLUT1 Venus Knock In Mice, synaptosomes were purified using sucrose sedimentation followed by FAC sorting (titled Fluorescence Activated Synaptosome Sorting (FASS) in the paper). Samples were then separated using SDS-PAGE and then analyzed by LC-MS/MS.. Experimental description: GENERATION OF VGLUT1VENUS KI MICE. The targeting vector was constructed on the basis of a 14 kb genomic clone of the VGLUT1 locus in pBluescript, which had been isolated from a λFIXII genomic library of the SV129 mouse strain (Stratagene). In the targeting vector, the STOP codon in the last coding exon (exon 12) of the VGLUT1 gene was replaced in-frame by a venus-loxP-neor-loxP cassette using recombineering techniques with engineered primers. The Venus cDNA was kindly provided by Dr. A. Miyawaki (RIKEN, Wako, Japan), and the recombineering toolbox was provided by Dr. N. Copeland (NCI, Frederick, MD). The venus-loxP-neor-loxP cassette was inserted between a 6.7 kb genomic sequence in 5′ position and a 7.9 kb genomic sequence in 3′ position (Fig. 1C). Mice carrying the mutated VGLUT1VenusNeo gene (VGLUT1vn/+) were generated by homologous recombination in embryonic stem cells (SV129/ola) as described previously (Thomas and Capecchi, 1987; Augustin et al., 1999) and identified by Southern blotting or PCR (Fig. 1D,E). To eliminate deleterious effects of the neomycin resistance gene, we crossed heterozygous VGLUT1vn/+ mice with EIIa-cre mice that express Cre recombinase in early embryonic stages (Lakso et al., 1996). Successfully recombined VGLUT1Venus alleles (v/+) in offspring from these interbreedings were genotyped by PCR (Fig. 1D). Except for initial comparative analyses of VGLUT1VenusNeo and VGLUT1Venus mice (Fig. 1), Cre recombined VGLUT1Venus mice were used for all experiments. All experiments were performed with littermates derived from crossing heterozygous VGLUT1v/+ or homozygous VGLUT1v/v mice (F2 SV129/ola × C57BL/6 genetic background). All live imaging experiments were performed on VGLUT1v/v mice. The probe used for embryonic stem (ES) cell screening by Southern blot was amplified from the VGLUT1 locus. It is located on the mouse chromosome 7 contig NT_039424.7 at position 6081938–6082223. The following oligonucleotides were used for genotyping PCRs: 9420, CTGGCTGGCAGTGACGAAAG; 9421, CGCTCAGGCTAGAGGTGTATGGA; 9423, CTTCAAGATCCGCCACAACATCG; 4174, CGCATCGCCTTCTATCGCCTTCTT. Oligonucleotides 9420 and 9421 were used to amplify the WT VGLUT1 allele, oligonucleotides 9421 and 9423 were used to amplify the VGLUT1v allele, and oligonucleotides 9421 and 4174 were used to amplify the VGLUT1vn allele. (Herzog et. al. In vivo imaging of intersynaptic vesicle exchange using VGLUT1 Venus knock-in mice. J Neurosci 2011 Oct 26: 31(43): 15544-59. PMID: 22031900)GENERATION OF VGLUT1VENUS KI MICE. The targeting vector was constructed on the basis of a 14 kb genomic clone of the VGLUT1 locus in pBluescript, which had been isolated from a λFIXII genomic library of the SV129 mouse strain (Stratagene). In the targeting vector, the STOP codon in the last coding exon (exon 12) of the VGLUT1 gene was replaced in-frame by a venus-loxP-neor-loxP cassette using recombineering techniques with engineered primers. The Venus cDNA was kindly provided by Dr. A. Miyawaki (RIKEN, Wako, Japan), and the recombineering toolbox was provided by Dr. N. Copeland (NCI, Frederick, MD). The venus-loxP-neor-loxP cassette was inserted between a 6.7 kb genomic sequence in 5′ position and a 7.9 kb genomic sequence in 3′ position (Fig. 1C). Mice carrying the mutated VGLUT1VenusNeo gene (VGLUT1vn/+) were generated by homologous recombination in embryonic stem cells (SV129/ola) as described previously (Thomas and Capecchi, 1987; Augustin et al., 1999) and identified by Southern blotting or PCR (Fig. 1D,E). To eliminate deleterious effects of the neomycin resistance gene, we crossed heterozygous VGLUT1vn/+ mice with EIIa-cre mice that express Cre recombinase in early embryonic stages (Lakso et al., 1996). Successfully recombined VGLUT1Venus alleles (v/+) in offspring from these interbreedings were genotyped by PCR (Fig. 1D). Except for initial comparative analyses of VGLUT1VenusNeo and VGLUT1Venus mice (Fig. 1), Cre recombined VGLUT1Venus mice were used for all experiments. All experiments were performed with littermates derived from crossing heterozygous VGLUT1v/+ or homozygous VGLUT1v/v mice (F2 SV129/ola × C57BL/6 genetic background). All live imaging experiments were performed on VGLUT1v/v mice. The probe used for embryonic stem (ES) cell screening by Southern blot was amplified from the VGLUT1 locus. It is located on the mouse chromosome 7 contig NT_039424.7 at position 6081938–6082223. The following oligonucleotides were used for genotyping PCRs: 9420, CTGGCTGGCAGTGACGAAAG; 9421, CGCTCAGGCTAGAGGTGTATGGA; 9423, CTTCAAGATCCGCCACAACATCG; 4174, CGCATCGCCTTCTATCGCCTTCTT. Oligonucleotides 9420 and 9421 were used to amplify the WT VGLUT1 allele, oligonucleotides 9421 and 9423 were used to amplify the VGLUT1v allele, and oligonucleotides 9421 and 4174 were used to amplify the VGLUT1vn allele. (Herzog et. al. In vivo imaging of intersynaptic vesicle exchange using VGLUT1 Venus knock-in mice. J Neurosci 2011 Oct 26: 31(43): 15544-59. PMID: 22031900)
Title
  • Actbl2_CC_802
Date
  • 2017-06-20
Contributor
http://purl.org/pav/providedBy
http://geneontology.org/lego/modelstate
  • production
Faceted Search & Find service v1.17_git150 as of Jan 20 2025


Alternative Linked Data Documents: iSPARQL | ODE     Content Formats:   [cxml] [csv]     RDF   [text] [turtle] [ld+json] [rdf+json] [rdf+xml]     ODATA   [atom+xml] [odata+json]     Microdata   [microdata+json] [html]    About   
This material is Open Knowledge   W3C Semantic Web Technology [RDF Data] Valid XHTML + RDFa
OpenLink Virtuoso version 08.03.3332 as of Jan 29 2025, on Linux (x86_64-generic-linux-glibc25), Single-Server Edition (378 GB total memory, 21 GB memory in use)
Data on this page belongs to its respective rights holders.
Virtuoso Faceted Browser Copyright © 2009-2025 OpenLink Software